| Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
|---|---|---|---|---|---|---|
| Trre11g03398 | ATGGTAGCACCAAGACCAAACACATTTATGCCGTTTGGAAACGGAGTCCACTCTTGTCCAGGAAGTGAAATGGCTAAGCCTCAGGAATATGTGCATGGCAATCAATTAAGAGGTTCTATTGTTAATAAGATGATTAAATTTGTGTTATCTGTAGGAATCTCTCTGCTAACAACTTCAAGGGGAATATACCGGTTGAGTTGGGTCACATCGTTAATCTTGGGACCTATCTAG | 231 | 0.4069 | MVAPRPNTFMPFGNGVHSCPGSEMAKPQEYVHGNQLRGSIVNKMIKFVLSVGISLLTTSRGIYRLSWVTSLILGPI | 76 |
| Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
|---|---|---|---|---|---|---|---|---|
| Trre11g03398 | 76 | SUPERFAMILY | Cytochrome P450 | 5 | 28 | IPR036396 | GO:0004497|GO:0005506|GO:0016705|GO:0020037 | |
| Trre11g03398 | 76 | ProSitePatterns | Cytochrome P450 cysteine heme-iron ligand signature. | 12 | 21 | IPR017972 | GO:0005506|GO:0016705 |
| Select | Gene | Chromosome | Start | End | Duplicated_type |
|---|---|---|---|---|---|
| Trre11g03398 | Trre-Chr11 | 46274544 | 46275170 | Transposed |
| Select | Gene | Gene_start | Gene_end | Function | Ath_gene | Identity(%) | E-value | Score |
|---|---|---|---|---|---|---|---|---|
| Trre11g03398 | 2 | 26 | Cytochrome P450 | AT5G45340 | 80.000 | 2.94e-11 | 55.5 |
| Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
|---|---|---|---|---|---|---|
| Trre11g03398 | K09843 | - | thj:104800678 | 57.7658 |