Gene search
Sequence information
| Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
|---|---|---|---|---|---|---|
| Trme948244g00001 | GAAACTGACATCGGAAGGAACGTGAATCAGTTGCGAAAACATCCATCGAGCGATGTTCGCAGATTGGTGAAGCTACTTGTCAAGTAA | 87 | 0.4483 | ETDIGRNVNQLRKHPSSDVRRLVKLLVK | 28 |
Annotation information
| Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
|---|---|---|---|---|---|---|---|---|
| Trme948244g00001 | 28 | Gene3D | Conserved domain common to transcription factors TFIIS, elongin A, CRSP70 | 1 | 28 | IPR035441 | - | |
| Trme948244g00001 | 28 | Pfam | TFIIS helical bundle-like domain | 1 | 28 | IPR017923 | - | |
| Trme948244g00001 | 28 | ProSiteProfiles | TFIIS N-terminal domain profile. | 1 | 28 | IPR017923 | - | |
| Trme948244g00001 | 28 | PANTHER | MEDIATOR OF RNA POLYMERASE II TRANSCRIPTION SUBUNIT 26C-RELATED | 1 | 28 | IPR044790 | - | |
| Trme948244g00001 | 28 | SUPERFAMILY | Conserved domain common to transcription factors TFIIS, elongin A, CRSP70 | 1 | 28 | IPR035441 | - |
Transcription factors information
| Select | Regulatory Factors | Family | Gene | Hmm_acc | Hmm_name | E_value | Clan |
|---|---|---|---|---|---|---|---|
| TR | IWS1 | Trme948244g00001 | Med26 | 5.4e-06 | No_clan |
Pathway information
| Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
|---|---|---|---|---|---|---|
| Trme948244g00001 | - | - | vvo:131598346 | 55.8398 |