| Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
|---|---|---|---|---|---|---|
| Trme568461g00001 | ATGGATTCACTTAATAAGAACTATGTTGATATGGATGAGTACCCTGTCACCACTGAACTTCAG | 63 | 0.381 | MDSLNKNYVDMDEYPVTTELQ | 21 |
| Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
|---|---|---|---|---|---|---|---|---|
| Trme568461g00001 | 21 | MobiDBLite | consensus disorder prediction | 1 | 21 | - | - |
| Select | Gene | Gene_start | Gene_end | Function | Ath_gene | Identity(%) | E-value | Score |
|---|---|---|---|---|---|---|---|---|
| Trme568461g00001 | 1 | 21 | Calmodulin-binding Proteins | AT3G17760 | 95.238 | 7.02e-09 | 45.4 |
| Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
|---|---|---|---|---|---|---|
| Trme568461g00001 | K01580 | - | psat:127095038 | 47.3654 |