Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
---|---|---|---|---|---|---|
Pste6g01776 | atggcgtccttgcagcaccccacagctttccttcaatccaatcacgtggtaatctcccgaaacagcctcagccacaaacccatcggcagcctctctcttcccttgacggccctgaagctgaaattggccgtgagccgccgctccaccggcgcctccggggccagaatgtcggcgactgctgcagccagttacgcctccgccctggccgacgtggccagcgcgaacaacaccctggacgcgaccaccgcggacatagagaaaatcgaggaaatattctcggacccggcggtgtcggaatacttcgcggatccaaccttggaagtggagaagaagcggaagttggtggacgagattgcggaatcatcggggttccaggcccacactagaaacttcctctacatcatagttgacgctcagaggatcgacctcataagcgagatcgccaaggagttcgagtccgtctataactctttgaccgacaccgagcttgcggtggtgacctccgtcgtgaagttggagtcccagcacttggcgcagatcgctaagcaggttcagaagctcaccggagccaacaacgtcaggattaagaccctccttgacccttctttggtcgccggtttcaccgtcaggtatggcaattccggctccaagttgattgatatgagcgtccggaagcagctcgaagatattgctactcagcttgagttgggtgatatcaaacttgccgtatga | 732 | 0.0 | MASLQHPTAFLQSNHVVISRNSLSHKPIGSLSLPLTALKLKLAVSRRSTGASGARMSATAAASYASALADVASANNTLDATTADIEKIEEIFSDPAVSEYFADPTLEVEKKRKLVDEIAESSGFQAHTRNFLYIIVDAQRIDLISEIAKEFESVYNSLTDTELAVVTSVVKLESQHLAQIAKQVQKLTGANNVRIKTLLDPSLVAGFTVRYGNSGSKLIDMSVRKQLEDIATQLELGDIKLAV | 243 |
Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
---|---|---|---|---|---|---|---|---|
Pste6g01776 | 243 | Coils | Coil | 71 | 91 | - | - | |
Pste6g01776 | 243 | Hamap | ATP synthase subunit delta [atpD]. | 56 | 236 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | PRINTS | ATP synthase delta subunit signature | 129 | 140 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | PRINTS | ATP synthase delta subunit signature | 209 | 227 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | PRINTS | ATP synthase delta subunit signature | 191 | 206 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | PRINTS | ATP synthase delta subunit signature | 140 | 154 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | PRINTS | ATP synthase delta subunit signature | 60 | 79 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | ProSitePatterns | ATP synthase delta (OSCP) subunit signature. | 193 | 212 | IPR020781 | GO:0015986|GO:0016020|GO:0046933 | |
Pste6g01776 | 243 | PANTHER | ATP SYNTHASE DELTA CHAIN | 43 | 235 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | Pfam | ATP synthase delta (OSCP) subunit | 61 | 234 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | NCBIfam | ATP synthase F1 subunit delta | 61 | 234 | IPR000711 | GO:0015986|GO:0046933 | |
Pste6g01776 | 243 | Gene3D | - | 60 | 153 | IPR026015 | - | |
Pste6g01776 | 243 | SUPERFAMILY | N-terminal domain of the delta subunit of the F1F0-ATP synthase | 57 | 159 | IPR026015 | - |
Select | Gene | Gene_start | Gene_end | Function | Ath_gene | Identity(%) | E-value | Score |
---|---|---|---|---|---|---|---|---|
Pste6g01776 | 50 | 242 | Primary Pumps ATPases | AT4G09650 | 68.912 | 1.31e-96 | 280 |