| Select | Gene | Cds | Cds_length | GC_content | Pep | Pep_length |
|---|---|---|---|---|---|---|
| Ahy11g1375 | ATGGCAAAGGGAAAGAGAAGGGCGGTGGAGGAACCAGTGGACAAGGCCAGCCTTCAGAAACAGAGACGCATGATCAAGAATCGTGAGTCTGCTGCTAGGTCTATGAACGCAAACAGGCTGAAAAGAAAGAGGTTGAAGGAGAAGAAGGAGGTGCTTGATGAGAATGAGTGGTGGGACAAGATAGGGAAGATGAAGATGCTTGGGAAAAAAAAGCCATGCTTATAA | 225 | 0.4711 | MAKGKRRAVEEPVDKASLQKQRRMIKNRESAARSMNANRLKRKRLKEKKEVLDENEWWDKIGKMKMLGKKKPCL* | 75 |
| Select | Seq ID | Length | Analysis | Description | Start | End | IPR | GO |
|---|---|---|---|---|---|---|---|---|
| Ahy11g1375 | 74 | Coils | Coil | 35 | 55 | - | - | |
| Ahy11g1375 | 74 | MobiDBLite | consensus disorder prediction | 1 | 37 | - | - | |
| Ahy11g1375 | 74 | MobiDBLite | consensus disorder prediction | 1 | 29 | - | - |
| Select | Gene | Chromosome | Start | End | Duplicated_type |
|---|---|---|---|---|---|
| Ahy11g1375 | Ahy-Chr11 | 50702307 | 50703972 | Dispersed |
| Select | Gene | Gene_start | Gene_end | Function | Ath_gene | Identity(%) | E-value | Score |
|---|---|---|---|---|---|---|---|---|
| Ahy11g1375 | 2 | 34 | bZIP Transcription Factor Family | AT5G44080 | 73.529 | 1.19e-08 | 47.8 |
| Select | Query | KO | Definition | Second KO | KEGG Genes ID | GHOSTX Score |
|---|---|---|---|---|---|---|
| Ahy11g1375 | K14432 | - | ahf:112720842 | 105.145 |